MASSIVELY PARALLEL SEARCH ENGINE IN FPGA

HI ..
I'm designing a massively parallel search engine in a FPGA (VIRTEX PRO)
The idea is to search by brute force a particular patern or a combination of patterns .It is possible to do multicriteria search .. like search "names of people with 40 years old or more ,and blind living in brussels "
This implies searching on data that is not indexed .Also another application of a typical seacrh would be .. looking for ..the ocurrence of "AGGGCTTTAAAAGCGCGCGCGCGCG" on a genome data base ..
Now according to my first evaluation it can be possible to search 50 gigabytes per second using 8 FPGAs .. Now this implies big reservoirs of DRAM memories ..But i'm out of touch with SDRAM or DDR memories ..
So i need to evaluate what are the current read access time with dram .
i don't want to use banking ,want to keep my solution very inexpensive ..
Also i see a big application of this technology as internet search engines
Does any body knows how is this done by let's say yahoo .. what kind of equipment they use .. and how fast they do it .. also what is the cost of their equipment .. Please if you have some thing useful to comment on the above ..please do

summerizing

1) DRAM reservoir specs
2) Yahoo typs of search equipment
3) Yahoo equipment prices
4) how fast is their equipment

There is application like yours in networking - looking for IP addresses in the router tables. Special ICs (NSE - Network Search Engines) are used for this purposes. They are just a content-addressable memory (CAM) with some additional hardware for record aging, masks support etc. Check Cypress, Mosaid, AMCC, ISSI sites for details (keyword: NSE). With CAM you can achive the highest possible searching speed, because they can search for match in all memory locations at once.

Ace-X.

NO... NO .. with multicriteria .. you can't use CAMS .. there is no fixed format !..on top is not just exact match .but you want to deal with mispellings of data and intervals of match .. One possible way to deal with this is using something like the Smith-Waterman algorithm wich rates the "best possible match" .Besides i want later to implement logical search operations ..
like search " NOT blond girls OR japaneese " Anyways .. i need HELP in the summerized topics in the first POST ..by now i have a NICE ARCHITECTURE in mind !

look here:

**broken link removed**

Have a look on the xilinx web site applications area. There are app notes for DDR, QDR etc interfaces at several hundred MHz.

Git

Also look this (old.... 12 years? ) hardware searching engine ...
**broken link removed**
**broken link removed**

You can find more infos on this checking adiacent subject: implementation of BLAST algoritm in FPGAs.

OK! If you can find or buy this book, I think it can help you very much:
"A Guide to Search Engines and Networking Memory, Fourth Edition".
A summery of this document could be find at:
**broken link removed**
(If you buy it, please upload it for me too